ID: 964649309_964649315

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964649309 964649315
Species Human (GRCh38) Human (GRCh38)
Location 3:158993006-158993028 3:158993045-158993067
Sequence CCTTGCTATAGAGCCATGTGGGA ATATAGAGACTTCACTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112} {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!