ID: 964659950_964659955

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964659950 964659955
Species Human (GRCh38) Human (GRCh38)
Location 3:159109257-159109279 3:159109296-159109318
Sequence CCTTTCTCCAACTGTGGTAATTT CTTTCTGTCAGGCTTACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 307} {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!