|
Left Crispr |
Right Crispr |
| Crispr ID |
964665203 |
964665211 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:159164488-159164510
|
3:159164522-159164544
|
| Sequence |
CCAGGCGCGGTGGCTAACACCTA |
CTTTGTAAGGCCAAGGTGGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 368, 2: 8811, 3: 60272, 4: 123399} |
{0: 9, 1: 1202, 2: 25860, 3: 80100, 4: 159731} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|