ID: 964666380_964666388

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 964666380 964666388
Species Human (GRCh38) Human (GRCh38)
Location 3:159178735-159178757 3:159178780-159178802
Sequence CCCTCAAACAGCTCTATACAGTG CAGTTGTAGGAGAAAACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159} {0: 1, 1: 0, 2: 1, 3: 22, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!