ID: 964682976_964682983

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 964682976 964682983
Species Human (GRCh38) Human (GRCh38)
Location 3:159362766-159362788 3:159362802-159362824
Sequence CCTTTGTGCTTTATCCCCATCCA TACTGCTGTCTCTACACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208} {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!