ID: 964704235_964704247

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 964704235 964704247
Species Human (GRCh38) Human (GRCh38)
Location 3:159601489-159601511 3:159601518-159601540
Sequence CCACCCTAGCCTTTGTTGGCAGT AGGTATGCAGAGGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146} {0: 1, 1: 1, 2: 5, 3: 76, 4: 1089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!