ID: 964704236_964704247

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 964704236 964704247
Species Human (GRCh38) Human (GRCh38)
Location 3:159601492-159601514 3:159601518-159601540
Sequence CCCTAGCCTTTGTTGGCAGTAGG AGGTATGCAGAGGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 97} {0: 1, 1: 1, 2: 5, 3: 76, 4: 1089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!