ID: 964706549_964706559

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 964706549 964706559
Species Human (GRCh38) Human (GRCh38)
Location 3:159624755-159624777 3:159624807-159624829
Sequence CCCAGAGATCCAGGGCCCCAAGG GTTGTGAGTCACAGCACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 253} {0: 1, 1: 0, 2: 2, 3: 23, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!