ID: 964723553_964723555

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 964723553 964723555
Species Human (GRCh38) Human (GRCh38)
Location 3:159791484-159791506 3:159791504-159791526
Sequence CCTGCTTGGGGCATCTGGCAACC ACCTCAGTCAAGTCACAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170} {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!