ID: 964724944_964724948

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 964724944 964724948
Species Human (GRCh38) Human (GRCh38)
Location 3:159804997-159805019 3:159805022-159805044
Sequence CCAGTCATCCTCAGCAGATTTCT TCAATCTCATTGGCCCAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 238} {0: 1, 1: 1, 2: 2, 3: 28, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!