ID: 964733186_964733190

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 964733186 964733190
Species Human (GRCh38) Human (GRCh38)
Location 3:159889424-159889446 3:159889441-159889463
Sequence CCAGAATAAAGAAAGACCTCTAA CTCTAACAGAAGTGGCCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 1026} {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!