ID: 964735489_964735492

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 964735489 964735492
Species Human (GRCh38) Human (GRCh38)
Location 3:159912904-159912926 3:159912918-159912940
Sequence CCTGTCTTTTGCAGTACCCACAA TACCCACAAGGTTTTTATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!