|
Left Crispr |
Right Crispr |
Crispr ID |
964789991 |
964790000 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:160445135-160445157
|
3:160445169-160445191
|
Sequence |
CCTGGTGTAATGGCTCATACCTG |
CTGTGGAAGGCCAAGGTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 105, 2: 2569, 3: 30831, 4: 95228} |
{0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|