|
Left Crispr |
Right Crispr |
| Crispr ID |
964789993 |
964790000 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:160445154-160445176
|
3:160445169-160445191
|
| Sequence |
CCTGTAATCCCAGCACTGTGGAA |
CTGTGGAAGGCCAAGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 88, 1: 12765, 2: 310723, 3: 261915, 4: 145751} |
{0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|