ID: 964826909_964826910

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 964826909 964826910
Species Human (GRCh38) Human (GRCh38)
Location 3:160838723-160838745 3:160838745-160838767
Sequence CCATCTCTAGTAAGGAGATGGAA ATTAGAGTAAGAGTTGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 253} {0: 1, 1: 0, 2: 3, 3: 28, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!