ID: 964831155_964831161

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 964831155 964831161
Species Human (GRCh38) Human (GRCh38)
Location 3:160885766-160885788 3:160885817-160885839
Sequence CCAACCCTGGAGCTGCGCAGATT TAAGCCTGCGGAGCTCCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 16, 3: 40, 4: 191} {0: 1, 1: 1, 2: 0, 3: 20, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!