ID: 964831155_964831163

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 964831155 964831163
Species Human (GRCh38) Human (GRCh38)
Location 3:160885766-160885788 3:160885819-160885841
Sequence CCAACCCTGGAGCTGCGCAGATT AGCCTGCGGAGCTCCCCTGGGGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 16, 3: 40, 4: 191} {0: 1, 1: 0, 2: 2, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!