ID: 964835223_964835225

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 964835223 964835225
Species Human (GRCh38) Human (GRCh38)
Location 3:160930632-160930654 3:160930649-160930671
Sequence CCAGGCTGAAGCCTCAAAGGAAC AGGAACCATCTCAAAATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 121} {0: 1, 1: 1, 2: 2, 3: 23, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!