ID: 964847987_964847990

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 964847987 964847990
Species Human (GRCh38) Human (GRCh38)
Location 3:161064405-161064427 3:161064453-161064475
Sequence CCATGAAAACTAAAGAGCCATTT GAATATGACCTTAATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 335} {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!