ID: 964851679_964851684

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 964851679 964851684
Species Human (GRCh38) Human (GRCh38)
Location 3:161102759-161102781 3:161102793-161102815
Sequence CCATGATCCATCCTGTTAAAAGC GGACATGATATAGTTGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146} {0: 1, 1: 0, 2: 1, 3: 20, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!