ID: 964878398_964878403

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 964878398 964878403
Species Human (GRCh38) Human (GRCh38)
Location 3:161395771-161395793 3:161395789-161395811
Sequence CCCAACGTTTCACAACCAGAAAA GAAAACAAGGAGAAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 267} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!