ID: 964881498_964881504

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 964881498 964881504
Species Human (GRCh38) Human (GRCh38)
Location 3:161428340-161428362 3:161428371-161428393
Sequence CCTGGGCTCAAATGATCCTTCCA TTCCACAGTGCTAGGATTACAGG
Strand - +
Off-target summary {0: 49, 1: 1440, 2: 12752, 3: 36117, 4: 72725} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!