ID: 964927366_964927377

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 964927366 964927377
Species Human (GRCh38) Human (GRCh38)
Location 3:161975368-161975390 3:161975412-161975434
Sequence CCCTGAAAGTGCAGGGATGCCCA AGCTGCAGCTGTGCCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 21, 3: 85, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!