ID: 964975036_964975038

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 964975036 964975038
Species Human (GRCh38) Human (GRCh38)
Location 3:162607612-162607634 3:162607652-162607674
Sequence CCTCTGTGCATCTGTGTATTCAA AGAACATTAGTAATTAGATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 326} {0: 1, 1: 0, 2: 2, 3: 30, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!