|
Left Crispr |
Right Crispr |
| Crispr ID |
964985575 |
964985578 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:162733554-162733576
|
3:162733575-162733597
|
| Sequence |
CCAGGCACAGTGGCTCACACCTG |
TGTACTCCCAGTACTTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5869, 1: 26036, 2: 70853, 3: 126100, 4: 140238} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|