ID: 965024075_965024078

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 965024075 965024078
Species Human (GRCh38) Human (GRCh38)
Location 3:163275911-163275933 3:163275936-163275958
Sequence CCTACCAACTCCTATGTTGTTAA AAAAACTGAATAATAATTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 67, 4: 782}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!