ID: 965094653_965094658

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 965094653 965094658
Species Human (GRCh38) Human (GRCh38)
Location 3:164209527-164209549 3:164209572-164209594
Sequence CCAGACACTCAGCTTTCCCAGCA ATCATTCCTGTCTCAACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 386} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!