ID: 965095122_965095129

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 965095122 965095129
Species Human (GRCh38) Human (GRCh38)
Location 3:164216271-164216293 3:164216312-164216334
Sequence CCAGGAGTAGGGGTCTATCCAGG TCTTCCATATGGCTATTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 13, 3: 23, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!