ID: 965154163_965154167

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 965154163 965154167
Species Human (GRCh38) Human (GRCh38)
Location 3:165025361-165025383 3:165025377-165025399
Sequence CCAAACCTAAGAATAGCTGGTGT CTGGTGTTCCTGAGGAAGAAGGG
Strand - +
Off-target summary {0: 3, 1: 38, 2: 351, 3: 464, 4: 602} {0: 3, 1: 4, 2: 19, 3: 44, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!