ID: 965190562_965190571

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 965190562 965190571
Species Human (GRCh38) Human (GRCh38)
Location 3:165522635-165522657 3:165522666-165522688
Sequence CCCTGAAGGACTTGTGCCTCCTT TAGGGGATAAAGAAGTGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 204} {0: 1, 1: 0, 2: 2, 3: 63, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!