ID: 965287115_965287125

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965287115 965287125
Species Human (GRCh38) Human (GRCh38)
Location 3:166830318-166830340 3:166830364-166830386
Sequence CCTGGGCCTTAACAATAGTCCCA TATTATCCACACTTTGAGGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!