ID: 965298786_965298792

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 965298786 965298792
Species Human (GRCh38) Human (GRCh38)
Location 3:166984095-166984117 3:166984146-166984168
Sequence CCCAAGCCTCATAATTTTGTCAG CTGTTGAAGTGAAAGTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 146} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!