|
Left Crispr |
Right Crispr |
| Crispr ID |
965326460 |
965326462 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:167310228-167310250
|
3:167310255-167310277
|
| Sequence |
CCATTATCACTATAAGCATTTTG |
AAATCATTCAACAAGTCTCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 62, 3: 104, 4: 309} |
{0: 29, 1: 513, 2: 2153, 3: 1968, 4: 1454} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|