ID: 965327881_965327888

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 965327881 965327888
Species Human (GRCh38) Human (GRCh38)
Location 3:167330487-167330509 3:167330508-167330530
Sequence CCTAACCCCCAATGTGACTACAT ATTTTGAGATAGGGCCTATAAGG
Strand - +
Off-target summary {0: 2, 1: 38, 2: 151, 3: 453, 4: 1091} {0: 1, 1: 11, 2: 91, 3: 365, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!