|
Left Crispr |
Right Crispr |
| Crispr ID |
965327881 |
965327890 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:167330487-167330509
|
3:167330520-167330542
|
| Sequence |
CCTAACCCCCAATGTGACTACAT |
GGCCTATAAGGAGGTAATTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 38, 2: 151, 3: 453, 4: 1091} |
{0: 1, 1: 5, 2: 67, 3: 291, 4: 786} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|