ID: 965357159_965357163

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 965357159 965357163
Species Human (GRCh38) Human (GRCh38)
Location 3:167690289-167690311 3:167690316-167690338
Sequence CCACCCAAATTTGCATGATACGC ATGCAAATGCACTAATGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 71} {0: 1, 1: 0, 2: 1, 3: 30, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!