ID: 965377582_965377592

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 965377582 965377592
Species Human (GRCh38) Human (GRCh38)
Location 3:167944680-167944702 3:167944731-167944753
Sequence CCAACAAGAAACCATAGAAGTCA AAGTTTGAAAATAGACCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!