ID: 965408825_965408832

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 965408825 965408832
Species Human (GRCh38) Human (GRCh38)
Location 3:168304167-168304189 3:168304202-168304224
Sequence CCGCTGAGCCTCAGTGTCCAGAG TTTCATTACATAGGCAAGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 35, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!