ID: 965466283_965466287

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 965466283 965466287
Species Human (GRCh38) Human (GRCh38)
Location 3:169034548-169034570 3:169034563-169034585
Sequence CCTAAGGGAATGTCTCAGGGCTG CAGGGCTGAGCAAGGCAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 105, 4: 844}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!