|
Left Crispr |
Right Crispr |
| Crispr ID |
965511013 |
965511024 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:169568018-169568040
|
3:169568065-169568087
|
| Sequence |
CCCAGCTCATCTCATTGGGACTC |
GAGGGTGAGCAGAAGCAGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 83, 2: 391, 3: 959, 4: 1129} |
{0: 12, 1: 166, 2: 439, 3: 860, 4: 1755} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|