ID: 965511013_965511024

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 965511013 965511024
Species Human (GRCh38) Human (GRCh38)
Location 3:169568018-169568040 3:169568065-169568087
Sequence CCCAGCTCATCTCATTGGGACTC GAGGGTGAGCAGAAGCAGGATGG
Strand - +
Off-target summary {0: 2, 1: 83, 2: 391, 3: 959, 4: 1129} {0: 12, 1: 166, 2: 439, 3: 860, 4: 1755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!