ID: 965511014_965511024

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965511014 965511024
Species Human (GRCh38) Human (GRCh38)
Location 3:169568019-169568041 3:169568065-169568087
Sequence CCAGCTCATCTCATTGGGACTCG GAGGGTGAGCAGAAGCAGGATGG
Strand - +
Off-target summary {0: 3, 1: 117, 2: 371, 3: 425, 4: 297} {0: 12, 1: 166, 2: 439, 3: 860, 4: 1755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!