ID: 965511768_965511775

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 965511768 965511775
Species Human (GRCh38) Human (GRCh38)
Location 3:169575574-169575596 3:169575616-169575638
Sequence CCTTGTCCTGCTTTTATCTTACA CTTAGAAGGCTTTTGGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 291} {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!