ID: 965530464_965530473

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 965530464 965530473
Species Human (GRCh38) Human (GRCh38)
Location 3:169765518-169765540 3:169765550-169765572
Sequence CCTGCCCCCTTCTCCTTAGAATG GCCTCTCCTTGAGCAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 261} {0: 1, 1: 0, 2: 6, 3: 31, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!