ID: 965535362_965535370

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 965535362 965535370
Species Human (GRCh38) Human (GRCh38)
Location 3:169818169-169818191 3:169818206-169818228
Sequence CCCACAGTCACTTTCCTCTCCCT TATTCTCTCTCTGTGCCACATGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 24, 3: 78, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!