ID: 965542755_965542760

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 965542755 965542760
Species Human (GRCh38) Human (GRCh38)
Location 3:169886881-169886903 3:169886920-169886942
Sequence CCAGGACACTTTAGGAATCTCTG CTCTTGGCAGGAAACCAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!