ID: 965551136_965551147

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 965551136 965551147
Species Human (GRCh38) Human (GRCh38)
Location 3:169966601-169966623 3:169966634-169966656
Sequence CCTCCACGTCCTAACGATTCTCC CAGCAGGAGCGGAGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 57, 4: 1028} {0: 1, 1: 0, 2: 5, 3: 71, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!