ID: 965596887_965596894

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 965596887 965596894
Species Human (GRCh38) Human (GRCh38)
Location 3:170419185-170419207 3:170419203-170419225
Sequence CCTGCCGCAAGCTGGATGAGCTG AGCTGGGCTCCAAGGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 130} {0: 1, 1: 0, 2: 5, 3: 70, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!