ID: 965608857_965608861

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965608857 965608861
Species Human (GRCh38) Human (GRCh38)
Location 3:170524049-170524071 3:170524095-170524117
Sequence CCTGTTTTGGGGAGAGGTAGGGT GTGGTGAAGGCCTCAATTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 217} {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!