ID: 965680691_965680702

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 965680691 965680702
Species Human (GRCh38) Human (GRCh38)
Location 3:171248222-171248244 3:171248261-171248283
Sequence CCTGTGGAGAACAATGAAGGCAG GAGAGGAGAGTGGTGGAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226} {0: 1, 1: 0, 2: 8, 3: 121, 4: 1313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!