ID: 965683189_965683198

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 965683189 965683198
Species Human (GRCh38) Human (GRCh38)
Location 3:171273225-171273247 3:171273260-171273282
Sequence CCTGGAGCTACAGGGACCCACCT AGTCTGGAGGTTCAATCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 309} {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!